Skip to main content

Table 1 List of different PCR primers used in the study

From: Combination of dasatinib and curcumin eliminates chemo-resistant colon cancer cells

Gene Specificity Direction Primer Sequence
CD 44 Mouse Forward ctccagacaaccaccaggat
CD 44 Mouse Reverse tgtggggtctcctcttcatc
CD 133 Mouse Forward tcaaagggacccagaaactg
CD 133 Mouse Reverse gccttgttcttggtgttggt
CD 166 Mouse Forward ctcgttgctggtgtcgtcta
CD 166 Mouse Reverse tccaatccgctcctctctta
ALDH 1a Mouse Forward gggctgacaagattcatggt
ALDH 1a Mouse Reverse ggaaaattccaggggatgat
Actin Mouse Forward agatctggcaccacaccttc
Actin Mouse Reverse ggggtgttgaaggtctcaaa
CD 44 Human Forward aaggtggagcaaacacaacc
CD 44 Human Reverse actgcaatgcaaactgcaag
CD 133 Human Forward accgactgagacccaacatc
CD 133 Human Reverse ggtgctgttcatgttctcca
CD 166 Human Forward tagcaggaatgcaactgtgg
CD 166 Human Reverse cgcagacatagtttccagca
ALDH 1a Human Forward gttgtcaaaccagcagagca
ALDH 1a Human Reverse ctgtaggcccataaccagga
Actin Human Forward cccagcacaatgaagatcaa
Actin Human Reverse acatctgctggaaggtggac
  1. ALDH1a represents ALDH1.